John Michael
Cross-referencing over 67 channels for appearances
John Michael
Arcmira media summary
Arcmira tracks where John Michael appears across indexed YouTube videos, transcripts, channels, and related entities.
Yeah, I'm going to leave that up to uh John Michael, my editor.
All right, John. Michael, pause this for a second cuz um uh Oh, how do you said your brother-in-law knows me? Is that Yeah, he came to Philadelphia. I mean, I live into the show. Why did you come to Philadelphia? I came to perform for the for the hardworking people who the steel mills. Um, I'll tell you what. I'll go. That movie with uh Nicholas Cage, National Treasure. Your turn. That's why you came. Um, uh, Rick. Yeah. Yeah. Uh, yeah. Yeah. Um, I I I feel like I saw clips of yours coming up on on the old YouTube. I'm so sorry. Can I ask a question? Will you look or see if my if my head is in frame? Also, she's blocking me here. I don't know what that means to you. Yes. Is she completely blocking me? Completely. I'm such an [ __ ] I moved it. I wasn't thinking she was moving. You got the uh the silver YouTube thing over there. What does that mean? Passing 100,000 subscribers. Yeah. Is am I is my head in frame? Oh, thanks. I'll tell you what, she's not getting paid enough for being your camera operator as well. All right. All right. You got me. There's a Giuliard student if I've ever heard one. You know, I went to Giuliard. Yeah. Yeah, I knew that. Looks like Giuliard was worth it. Giuliard. Giuliard. Home run. For those of people that want to know a little BTS, I said, "Swipe to the Giuliard sketch." I don't think I've seen that one. Oh, it's the first sketch I did with my bud when we moved out here about how busy and tired we are cuz we went to Giuliard. Yeah. And who would have thought four years later? A real Giuliard guy. Yeah. You've been out here four years. I moved out here when I was 24. And you're now 28. Quicker than you. Nice. How old are you? Do you have to sneeze? Are you blocking the camera? I'm 3. I don't think so. No, no, no. You can see. Yeah. Okay. Ow. I'm 32 in uh uh week and a half. Oh, you're July guy. Yep. July 8th. I knew it. I knew it. You know, us we Cancers, we we we've got a lot. No, I'm not the eighth. I'm just July. Are you not a Cancer? I'm a Leo. Couldn't you tell? I couldn't have thought so. No, I'm just kidding. That was a Leo joke. What? No, it's fine. It's fine. It's good. Oh, no. Am I talking over you? No, no, no. It's I I It's It's to be honest, it's very confusing going from watching you on the, you know, the fully finished edited uh version of the She's blocked me again. You know, she can't work under these conditions. Good save. Um, uh, it's it's weird going from from watching you in like the finished edited, you know, version of the podcast. Do you really watch the podcast? I do. Yeah. I mean, not [ __ ] every time. Who has Whoa. Whoa. Whoa. I wasn't asking if you watch every time. Hey. Hey. Hey. Is for horses. Gay horses. We'll bleep that if Warner Brothers wants. But really, gay horses are like they're coming back. A lot of people, but I say no. [ __ ] A lot of people say, "Yay." Where did they go? Oh. Oh, I don't know. I was going to make a horse. I was going to make a n Wait, what? That was the joke. Just let me get a joke in and then we can work together. Dude, you're you're right and I'm wrong. What would you like? I don't know. Diet Coke. Yeah. I don't have diet, but I do have zero. I have um honestly I drink a full I haven't had dinner so I I Pepsi, root beer, Dr. Pepper, Sprite. What kind of root beer do you have? A&W. [ __ ] hell. Get a Barks, will you? Um Alvin, he's talking to you. Yeah. Yeah, I'll drink a Barks. I mean, no A&W. Whatever. I'm a big I'm a big root beer guy. I want to tell you something. Yeah. I apologize. I'll tell you how much I watch your podcast. Okay. I was about to take a sip of this and I heard in my headugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugug. I I What am I doing? Right side gulp. Right side. Do you want Is this okay? Yeah, this is great. Alvin, I am flattered. I subscribed to probably seven channels on YouTube. What are the other ones? For [ __ ] sake. Open Studio Jazz. You like jazz? I do now. Do you? Yeah. Yeah. I mean, like if I wouldn't say um like if if you were to make an analogy uh or even a metaphor uh and you were going to rank me how much I like jazz as like a spiritual figure, I wouldn't say I'm a felonious monk. Ow. I haven't been drinking this whole time, so don't put the sound over. Gold. Gold. My god, you got to try it. Everybody tells me to get massages. It's not It's not my bag. I Oh gosh, that's a great question. Um, why you should interview him? Oh, what's your doctor? No, this is your TFL. Oh, tough [ __ ] luck. Quicker than me. I was trying. I was thinking gears were going, dude. So, I walked in and you guys were you and Nicholas Stler, which by the way, how come he doesn't play a boy anymore? He was so good as a boy. What did you call him? Nicholas Stler. Not the same guy. Oh, Nicholas Stler is the guy who does the who my cousin babysat for and does he's a director and a writer. Nicholas um you know, the white guy. That's for sure. Wait, why don't I give me a hint, but don't make it an easy hint, but make it like a medium hint. Gulp. Gulp. Gulp. How does this feel? Pretty good. So, what So, what So, what happened to your leg? I was running I running away from the security guard. Yeah. You realized when you cut to the clip, I can't see the clip. Yeah, man. I also realized that you heard my direction, so you probably knew what was going on. So, are you supposed to get a massage this soon after a major injury? Is this how This is how I am all the time. This is how I am all the time. Is this how Tommy Gun directs your movies? Jimmy Gun. We call him Jimmy Gun. We call him Jimmy Finger Guns because he's always doing the finger guns. Does he? No. Oh, because if so, I was going to cut to a clip. Would you text him? Would you text James Gunn and ask him, "Hey, for a podcast, I need I need a video of you looking at the camera and saying, I'm what is what you what did you say? His name is Jimmy Gun." Say, "I'm Jimmy Guns." And go like this. Yeah. I'm Jimmy Gun. [Laughter] Really? Absolute magic. Absolute magic Jackie. Magic Jackie. That's what he That's what he calls you. All right. He rarely responds to me. So, we'll see. Really? Cuz I hear uh Chris Pratt, he writes back all the time. Anyway, how much re how many hours of research did you have to do to figure out that Chris Pratt was the other guy that he's worked with a lot? How much research did I have to know about James Gun? Yeah, dude. I make my guests into It's not on your shirt. I make my guests into superheroes. Um, I don't I haven't seen this. It's actually awesome. It's all [ __ ] awesome. Oh, a action figures. Jesus. Trading cards. Yeah. Oh, yeah. You you um you were you were um hawking these at your uh standup show, huh? Bobby Lee. So, um I the most recent card that's about to come out. I have it as a shirt is Alvin as Rocket from Guardians of the Galaxy. Dude, so you a big uh Guardians fan? Yeah. I mean, being from Cleveland, you're not supposed to say Indians anymore. Yeah. Um, but I'm I'm a I'm a big fan of like You're not friends with people. I like Marvel. I'm about to love DC, dude. What's the What's the uh what's the cut off for friend here? What do you mean? Like, how close do you have to be to somebody to make them a trading card? You want to be one? I didn't say that. All right. But maybe but I believe in direct communication. Well, I'm just I asked a question and you didn't answer it. How direct is that? Uh, is that jazz Star Wars? YouTube's going to flag this. Yeah, you're going to How much of it can you play before? Usually I let the whole thing play out. Is is uh is that uh ah for a certain person or is that your ring for every day? No, that's my alarm. That's what I wake up to every morning. Oh, really? Just get the day started. Man, I wonder if I woke up to that if I would feel a little bit better, too. What do you wake up to? I have this um voice note that says, "You [ __ ] loser. Get out of bed, you [ __ ] scum." Really? No, I just wake up to whatever my phone default alarm is. Oh, well, yeah, you should. You should um you should make it a you should try some music. You should try a song. All right. The the trick is to do something. You have to find the right one. Cuz if you do a song that you like, but that isn't the right song. You'll get sick of it real fast. I've had that alarm as my alarm for 10 years, and I can still listen to the whole song all the way through and enjoy it. Wow. Is that's not John Williams, is it? It is John Williams. I thought that's why you made the Star Wars joke. No, that was Lucas. Lucas uh helped uh uh or Lucas did it. Spielberg gave it to Lucas. What? You went to Giuliard. You know what I'm talking about. Who directed Indiana Jones? Spielberg. Lucas gave it to Spielberg. Lucas gave it to Spielberg. Yeah. The other way around. That's what I'm saying. Well, yeah. Rewind it back. Show what I said and then have it say have it say this in slow motion. What you What do you want me to do? You want me to mess make it wrong? I tell you what. Hey, play this. Okay, because this is real. I watch your podcast and when you say cut back to what I said, I always remember what was said. And when you're right, you're right. And it's fun to like go back and have be able to do that in a podcast. I can't do that in real life. I just have to convince somebody that they in fact said what I remember them saying. So, what do you think I said? You 100% said Spielberg gave it to Lucas, but now you're gonna cut to the thing and Nope. I am 100% sure. Sorry. Spielberg to Lucas. Nope. It's in. That's the one we're using. [Laughter] Do you want to try this? No. Okay. Nothing against you, Jackie. I'm sure you're great at what you do. Probably you're probably too good at what you do. I I've had like three massages in my life, and everybody tells me, "Oh, you should do it. You should do it. You should do And then every couple of years I forget and do one. And then I'm like, "That was fine." Okay, do yourself a favor. Look at you. Okay, now look at me. I'm only 28 years old because I get massages all the time. Oh, that this Oh, that's a spot. That's one of the ones that hurt but feels good. All right, I think I want I want to I got to We got to I got to do the podcast. I got to be professional. Just like 20 more minutes. No. No. Um, is are we evened out? Do you need to do another leg? Can you walk around and see? Now you're really putting me on the spot. We called the dog Indiana. We'll be right back with a word from our sponsors. You've been holding that the whole episode, huh? Oh, yeah. Well, I love this. Tell me about it. Seriously, it is so good. You do nothing. It takes 2 minutes to heat up. It comes completely with your dressings, your sauces, whatever. Cranberry sauce, veggies, and mashed potatoes and turkey. Well, that sounds like that would be great for Thanksgiving, but it's probably $300, right? No. And you know what else? It's only 480 calories. This one I love. There was a meal I've had from Factor that isn't yum. I just had one today for lunch. I've never had it before. It was the chicken taco. It was delicious. It was as good as anything I would have bought from my Mexican restaurant. Factor meals arrive fresh and easy. Ready to eat. You can't say Mexican. Perfect for any active lifestyle over summer and beyond. Factor powers your day. Sun up to sun down. It says so right here. Get started at factormeals.com/tyo50 off and use code tao50 off to get 50% off plus free shipping on your first box. That's code. Can I say something else? They also have breakfasts and protein drinks and desserts. That's code ty 50 off at factormeals.com/tessa50 off for 50% off plus free shipping. Factormeals.com/factor 50% off. Is that right? Tao 50 off. Oh, tao. Tao 50 off. Love it.
3
Mentions
978.5K
Views

"Yeah, I'm going to leave that up to uh John Michael, my editor."

"All right, John. Michael, pause this for a second cuz um uh Oh, how do you said your brother-in-law knows me? Is that Yeah, he came to Philadelphia. I mean, I live into the show. Why did you come to P..."

"Oh, I also have to remind you uh John Michael um who uh edits this uh wants tickets to a show of yours."
Oh, I also have to remind you uh John Michael um who uh edits this uh wants tickets to a show of yours.
Arcmira tracks where John Michael appears across indexed YouTube videos, transcripts, channels, and related entities.
Arcmira uses indexed YouTube videos and transcripts. Representative source evidence on this page includes "Rhett & Link (Good Mythical Morning) on TYSO - #322" with transcript-derived context and links when available.